Isolation and identification of the pathogens
causing root rot disease of Chinese ephedraZHU Chun-yu1
, LIU Xi-li 1*, DONG Jin1, ZHOU Li-gang1 , LI Jian-qiang1 ,ZHANG Yong-qing2
, HE Bao-yin2 , CHEN
Yao-wen2 ,ZHANG Yu-ming2 (1Department
of Plant Pathology of China Agricultural University, Beijing 100094,China；2Ningxia Irrigation
Research Institute,Yinchuan 750000, China)
Abstract: Ten samples of root rot diseased Chinese
ephedra were collected from the base of Chinese ephedra in Ningxia area of China during 2001. Pathogenicity of fungal isolates obtained from these samples
was tested by
verifial standard means of the Koch's Postulation.
The results showed that the isolates mainly belonged to Fusarium spp.Infection analysis indicated that F. subglutinans had the strongest virulence
with a diseased seedlings rate of more than 60%, whereas pathogenicity rate ofF.
oxysporum, F. semitectum,
F. solani var.coeruleum and F. solani ranged
from 10% to 20%. When F. subglutinans was co-inoculated with other isolates, the diseased
indices of mixed inoculations were all higher than those of their individual
infection. The combined inoculations of F. subglutinans with F. oxysporum or F. semitectum induced higher rates of
diseased seedlings than those of F.
subglutinans with other fungi. Our results revealed that F. subglutinans was
the major pathogen of root rot disease of Chinese ephedra,
whereas F. oxysporum,F. semitectum and the
other two Fusarium species only played an accessory roles
in the complex infection.
Key words：Chinese ephedra;
root rot disease; complex infection
Analysis of ITS sequence and PCR protocol
for the detection of Clavibacter fangii,
the causal agent of wheat seedling wilting disease GE Yun-ying，GUO Jian-hua (Department
of Plant Pathology, College of
Plant Protection， Nanjing Agricultural University, Nanjing
210095， China)
Abstract: A polymerase chain reaction (PCR) protocol
was developed to specifically detect Clavibacter fangii
(Cf), the causal agent of wheat seedling wilting
disease. Generic PCR products from the internally transcribed spacer (ITS)
region of 16S－23S ribosomal DNA of Cf and other two related bacteria were cloned and sequenced.
Based on a multiple sequences alignment among these obtained sequences, a
pair of Cf-specific PCR primers I1(5＇TGCCAAGTCACACTGAGACGA 3＇)/I2（5＇CAATGATCTACCACCCTCCGA 3＇） were designed. These two oligonucleotides allowed specific amplification of a 351 bp DNA product from genomic DNA samples of Cf strains，but not from other 21 bacterial
isolates tested. The PCR protocol provides a rapid and reliable tool for routine
detection and identification of Cf. In addition, the classification implication
of ITS sequence homology was first found in bacteria by comparing sequences
from Clavibacterspp. and Rathayibacter tritici.
Key words:Clavibacter
fangii; ITS analysis; classification; detection
Isolation and identification of a Potato virus Y isolate in Shandong WANG Xiu-fang， ZHU Chang-xiang，WEN Fu-jiang*，ZHU Xiao-ping，GUO Xing-qi (College of Plant Protection, Shandong Agricultural University,
Taian 271018, China)
Abstract: An isolate of Potato virus Y (PVY-SD-TA) was isolated from potato leaves with typical
mosaic symptoms in Taian, Shandong Province,and maintainedin
Nicotiana tabacum cv. Samsun. Electron microscope study revealed
that the size of the purified virus particle was 700－900 nm×11 nm. Pine wheel inclusions were
found in the infected leaf. The study of host responses to virus infection
suggested that the PVY-SD-TA could infect plants of 13 species from 2 families.
The molecular weight of the coat protein (CP) subunit was 33 kDa as evaluated by SDS-PAGE. The CP gene was amplified by
RT-PCR using the genomic RNA as template and a pair of primers specific to
PVY. Sequencing results showed
that the homology between PVY-SD-TA CP gene and PVYN and PVYO
were 96% and 99%, respectively. According to these results, PVY-SD-TA was identified as
an isolate of PVYO strain.
Key words: Potato
virus Y;
coat protein; clone; sequencing
CELL BIOLOGY, PHYSIOLOGY, BIOCHEMISTRY AND MOLECULAR BIOLOGY
Effect of temperature and humidity on cell
wall degrading enzymes produced by Botrytis cinerea during infection of tomato plant LI Bao-ju, CHEN
Li-qin, MENG Wei-jun,
WANG Fu-jian (Institute of Vegetables and Flowers,
Chinese Academy of Agricultural Sciences, Beijing 100081, China)
Abstract: Four kinds
of cell wall degrading enzymes including carboxymethyl
cellulose(Cx), polygalacturonase(PG),polymethyl galacturonate(PMG) and
β-glucosidase, which produced by Botrytis cinerea during the infection of
tomato leaves,were investigated.PMG
showed the highest activity during the pathogen infection, and the β-glucosidase and PG were the next. The activities of these
enzymes varied with the temperature during the infection,
with the optimum for the highest enzyme activities is 25℃. Above 25℃,the enzyme activities decreased dramatically. Humidity also
effected the production of these cell wall degrading enzymes.The
enzyme activities increased with the increasing of relative humidity, and
the highest activities appeared when the relative humidity was up to 90%.
Our results showed that the effect of temperature and humidity on producing
of cell wall degrading enzymes was consistent with that on disease development
on tomato plants.
Key words: tomato gray mold rot; temperature; humidity;
cell wall degrading enzymes
Cloning and sequencing
hrp regulatory genes, hrpGXooc and hrpXooc,from Xanthomonas oryzae
pv.oryzicola
CHEN Gong-you, WANG Jin-sheng (Key Lab of Monitoring and Management of Plant Diseases
and Insects, Chinese Ministry of Agriculture, Dept.of
Plant Pathology, Nanjing Agric. Univ., Nanjing 210095, China)
Abstract: An hrp gene clone, pUHRS138, obtained
from a genomic library of Xanthomonas oryzae pv. oryzicola (Xooc)by using biparental conjugation
protocol, contained a 39.3-kb foreign DNA fragment. Series of subclones were achieved from the 39.3-kb hrp fragment
in pUHRS138 and hrp phenotype complementation by the subclones showed that a 4.5-kb BamHI-KpnI
DNA fragment could complement hypersensitive response (HR) elicitation on
tobacco to all hrp-mutants, but only restored the pathogenicity to an hrp- mutants, M1005,
on rice. The nucleotide sequencing revealed that hrpGXooc and
hrpXooc genes were located in the 4.5-kb DNA fragment.
Neither of these two hrp regulatory genes could restore HR or pathogenicity
to hrp- mutants of Xooc. Sequence comparison of hrpXooc with other
hrpX genes
of xanthomonads in GenBank showed
at least 83% identity. The differences in amino acids between HrpXooc and the other HrpX
proteins were found at the sites 32, 141, 164, 175, 213, 247 and 357. Interestingly,
no amino acid substitution was found in the region coding for the alpha-helix-turn-alpha-helix
structure which was conserved in HrpXooc and the other HrpX proteins.
The comparison of the four putative HrpG proteins
indicated that the HrpG in xanthomonads had a low similarity with the HrpG from Ralstonia solanacearum.The
comparison of HrpG Xooc
of Xooc with HrpG Xoo of Xanthomonas
oryzae pv.oryzae revealed four amino acid
alternatives at the sites 22, 29, 115, and 252. The alignments of HrpGXoocwith HrpGXoo
and HrpGXcvshowed that the amino acid
residues at two sites 3－9 and 216－220 were different. These suggest that HrpG in xanthomonads may sense environmental
signals and regulate hrp genes differently in different modes.
Key words: Xanthomonas
oryzaepv. oryzicola; hrp genes;
hrpGXooc; hrpXooc; functional
complementation
Localization of β-1,3-glucan
during interaction between wheat and barley and their powdery mildew pathogens LU Guang-xin, HU Dong-wei, ZHAO Shu-ang, XU Ying (Biotechnology Institute of Zhejiang University, Hangzhou 310029, China)
Abstract: The synthesis and distribution patterns
ofβ-1,3-glucan during the interaction between wheat
and its powdery mildew pathogen were examined with cytochemical
method. The results showed that there was no β-1,3-glucan
located in any parts of the pathogen, such as conidia, appressoria,
penetration pegs, haustoria, and hyphae.
In contrast, β-1,3-glucan wasfound
in the host cell walls, especially to be abundant in guard cells of stomas,
fibre cells,vessel elements, and
epidermal hairs. The pathogen infection could result in the accumulation of
β-1,3-glucan in the plant cell walls but not in the papilla formed
at the penetration sites. These contradicted the assumption that over expression
of β-1,3-glucanase genes in transgenic wheat could
enhance plant resistance against powdery mildew by directly digesting the
fungal haustoria and hyphae.Instead,
it can be supposed that the unsuitable expression would disturb the normal
development of plants.
Key words: wheat; powdery mildew; β-1,3-glucan; localization.callose formation
The effects of HMC-toxin on the protoplasts
and their actin filaments distribution in detached
root cap cells of Charrua cytoplasmic male sterility maize WANG
Li-an1 , MA Chun-hong 2 , ZHAO Jun-xia3 , WEI Jian-kun 2 (1 Hebei Normal University,
Shijiazhuang 050016, China; 2 Hebei Academy
of Agricultural and Forest Sciences, Shijiazhuang
050051,China; 3 Hebei Medical University, Shijiazhuang
050017, China )
Abstract: This experiment
was conducted by using detached root cap cells from Charrua cytoplasmic male sterility
maize(cms-C) seedlings for studying the changes
of protoplasts and their actin filaments(AFs) distribution.Before labeled
by a fluorescence probe (fluorescein –isothiocyanate-phalloidin, FITC-Ph), the detached cells were
treated with the toxin produced by
Bipolaris（Helminthosporium）maydis race C. By using fluorescent
microscope, the following results were obtained:1.
The protoplasts of cms-C shrank severely and gave
weak fluorescent
light; leakage of protoplasm with fluorescent light occurred; and the abnormal
distribution of AFs appeared. 2. The protoplasts in the cells of homokaryotic maintainer line(N) only
contracted slightly with the normal distribution of AFs.
3. There were apparently different effects between the HMC-toxins and cytochalasin B on the distribution of AFs.
4. The results raised the possibility of high correlation between the responds
of two kinds of detached root cap cells to HMC-toxin and their disease resistance.
Key words: Bipolaris（Helminthosporium）maydis race C; HMC-toxin; actin
filaments(AFs);
distribution
Influences of arbuscular
mycorrhizal fungi and Fusarium oxysporum f.sp.niveum on lipid peroxidation and membrane permeability in watermelon roots LI Min, WANG Wei-huan,
LIU Run-jin (Mycorrhiza
Laboratory, Laiyang Agricultural College, Laiyang, Shandong 265200, China)
Abstract: Influence of arbuscular mycorrhizal(AM) fungus,
Glomus versiforme，and Fusarium oxysporum f.sp.niveum
on malondiadehyde(MDA) content, autoxidation
rate and membrane permeability
in roots of watermelon was investigated under pot cultural conditions in greenhouse. Results showed that inoculation
with G.versiformein roots of watermelon
resulted in a lower level of MDA content, autoxidation
rate and membrane permeability compared with the non mycorrhizal
control. MDA content, autoxidation rate and membrane
permeability in roots pre-inoculated with G.versiformeand post-noculated with F.oxysporum f.sp. niveum
were lower compared with those in roots treated solely with F.oxysporum f.sp.
niveum. The decrease extent
of the MDA content, autoxidation rate and membrane
permeability was greater in susceptible cultivar “Zhengza
No.5” than in resistant cultivar “Jingxin No.1”.
Our results suggested
that inoculation
with G.versiforme could protect the membrane permeability
and reduce the damage caused by
F.oxysporum f.sp.niveum in watermelon plants.
Key words: arbuscular mycorrhizal
fungi; watermelon; Fusarium
oxysporum f.sp.
niveum ; malondiadehyde(MDA); autoxidation
rate; membrane permeability
GENETICS OF DISEASE-RESISTANCE AND PATHOGENICITY
Induced nitrate non-utilizing mutants of
Botrytis
cinerea and
their use
in vegetative compatibility tests GAO
Jun-ming, LIU Hui-ping,
WANG Jian-ming, LI Xin-feng,
HAN Ju-cai (Department of Plant Pathology, Agronomy
College,Shanxi Agricultural University, Taigu
030801, China)
Abstract: Eight single-spore isolates of
Botrytis cinerea
that belong to three different anastomosis groups
were obtained from grey mould cucumber plants collected from Yuncheng, Linfen, Changzhi, Jinzhong, Datong in Shanxi Province. All of
the 8 isolates produced chlorate-resistant sector on MMC media and nitrate
non-utilizing mutants (nit mutant),which
were recovered by transferring
the chlorateresistant sectors to the MM media containing nitrate as single nitrogen
source. Among the 59 nit mutants,
38 nit mutants were nit1, 10 nit mutants were nit3,and 11 nit mutants were nitM . Majority
of nit mutants were stable. Complementation
occurred between the different nit mutant phenotypes derived from the same parental strain or different
strain of the same anastomosis group. Complementation
occurred readily and reliably in nitM which was used
as the tester to identify the vegetative compatibility group to which isolates
B.cinereabelongs.
No complementation was observed between any nit
，mutants recovered from the strains
of different anastomosis groups.
Key words:Botrytis
cinerea; nit
mutant; vegetative compatibili
Disease resistance and inheritance analysis
of Cryptogein transgenic tobacco
plants JIANG Dong-hua1,2，GUO Ze-jian1*
(1 Institute of Biotechnology , Zhejiang
University, Hangzhou 310029， China； 2
College of Life and Environmental Science, Zhejiang
Normal University, Jinhua 321004， China)
Abstract: The transgenic tobacco plants were challenged
separately, with black shank fungal Phytophthora parasitica var. nicotianae, brown
spot fungal Alternaria alternata,and wild fire bacterial Pseudomonas syringaepv. tabaci. Most (80%) transgenic tobacco plants exhibited
high level resistance to these pathogens, although with variations of individuals.
Correlation analysis between the integrated copy numbers and disease resistance
to black shank showed that highly resistant plants usually contained only
one copy, and the susceptible plants contained 2-3 copies. Northern blot analysis
showed that the expression level of PR1
gene and Osmotin gene varied among transgenics
and had a positive correlation with the disease resistance. Observation of agronomic traits of some
transgenic tobacco plants indicated that the Cryptogein gene could promote growing of transgenic
tobacco plants.
Key words: elicitor; Cryptogein;
disease resistance; inheritance ；analysis; PR protein
Assessment and genetic analysis on the resistance
of a new
wheat line YW243 to stripe rust XIE Hao1,3,NIU
Yong-chun2， CHEN Xiao1， MA You-zhi1， WU Li-ren2， LIN Zhi-shan1
(1 Institute
of Crop Breeding and Cultivation, CAAS, Beijing 100081, China; 2 Institute
of Plant Protection, CAAS, Beijing 100094, China; 3 Beijing Agricultural
College, Beijing 102206, China)
Abstract： YW243,
a recently developed new source of resistance to wheat stripe rust, powdery
mildew and BYDV, was studied on its resistance to stripe rust. The results
of seedling test showed that it was resistant to all the contemporary prevalent
races of Puccinia striiformis in China, including CY29, CY30, CY31,
CY32 and CYSu-11. The result of postulation study showed that it had a wide
resistance spectrum, with resistance to all of the 26 isolates (races) collected
from various regions of the world. Of the 21 lines with known Yr genes, only the line with Yr5 had an RS similar to that of YW243,
but the pedigree of YW243 showed that the progenitor of YW243 did not include
Yr5 , indicating that the resistance gene
of YW243 is likely a new stripe rust resistance gene. A genetic study of a
cross using YW243 and Jing 771 as resistant and
susceptible parents revealed that the striperesistance
of YW243 to CY31 was controlled by a single dominant gene.A
preliminary molecular marker study revealed that this gene was linked to a
specific DNA segment amplified by a RAPD primer OPY08.
Key words：wheat; YW243; stripe rust; genetic
analysis
Pathotypes of Magnaporthe grisea Barr.
and their virulence to several rice Pi-genes
in Fujian Province LU Guo-dong， ZHENG
Wu， RUAN Zhi-ping， CHEN Zai-jie，WANG Zong-hua (College
of Plant Protection, Fujian Agriculture and Forestry
University, Fuzhou 350002, China)
Abstract: Rice blast, caused by Magnaporthe grisea Barr.,
is one of the most devastating diseases in rice production in Fujian, a southeastern rice producing
province of China. Continuous assay of the pathotype compositions and their interaction with known resistance
genes are essential for resistance breeding and resistance gene deployment.
In this study, 398 single spore isolates of the rice blast fungus collected
in this province during 1995－2001
were tested for pathogenicity using 6 CO39 near-isogenic lines (NILs). Twenty-six
pathotypes were detected, among which I34.1 was
the most predominant one consisting of 19.10% of the population. I20.1, I04.1,
I24.1, I0.1 and I30.1 also occurred at a relatively high frequency. The results
also showed that 7.53% and 11.31% isolates in the population were virulent
to Pi1 and to Pi2 respectively, and only 2.76% were virulent to both Pi1 and Pi, suggesting that pyramiding of Pi1 and Pi2 be applicable
in rice breeding for resistance.
Key words: rice blast fungus (Magnaporthe grisea Barr.); population structure;virulence frequencies;resistance breeding; Fujian
EPIDEMIOLOGY AND ECOLOGY
Resistance to wheat stripe rust induced
by avirulent race of Puccinia striiformis XIAO Yue-yan,WU Li-fen, WANG Zhuo-ran,
JIANG Wen-bo, ZENG Shi-mai (China Agricultural University, Beijing 100094, China)
Abstract: Seven wheat varieties were used in inoculation
with nine physiological races of Puccinia striiformis to study varietal
resistance to the compatible races after induction by incompatible races. The results
from greenhouse experiments showed that the induced resistance did exist in
many variety-race combinations. However, the degree of induced resistance
varied with the combinations. The induced susceptibility also existed in several
combinations. The effect of induced resistance lasted for 8 days,but was strongest 1-2 days after
inoculation.The time interval between inducing inoculation
and challenging inoculation had important effect on the expression of induced
resistance. The induced resistance was most remarkable when the time interval
was 24 h. When the time interval was 48 h, the induced resistance became comparatively
week. The amount of inoculums quantitatively affected the induced resistance.
An exponential relationship between concentration of spore suspension(X)
and the induced effect(Y) were obtained. The induced resistance
may play a certain role in the disease epidemics in certain combinations of
variety and race.
Key words: wheat stripe rust; physiological
races； induced
resistance
Pathogenic changes of stripe rust fungus
of wheat in China during 1997-2001 WAN An-min1,WU Li-ren1,JIA
Qiu-zhen2, JIN She-lin2, LI Gao-bao3, WANG
Bao-tong3, YAO Ge4, YANG Jia-xiu4, YUAN Zong-ying5,BI
Yun-qing6 (1 Institute
of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100094,China;
2 Institute of Plant Protection, Gansu
Academy of Agricultural Sciences, Lanzhou 730070,
China; 3Institute of Plant Protection, Shaanxi
Academy of Agricultural Sciences, Yangling 712100,
China; 4Institute of Plant Protection, Sichuan
Academy of Agricultural Sciences, Chengdu 610066,
China;5 Institute of Plant Protection, Shanxi
Academy of Agricultural Sciences,Taiyuan 030031,
China;6 Institute of Plant Protection, Yunnan
Academy of Agricultural Sciences, Kunming 650205,
China)
Abstract: Four thousand and eight
samples collected from 13 provinces (autonomous regions) in China during 1997-2001
were identified on 17 differential hosts, namely Trigo
Eureka (Yr6 ), Fulhard,
Lutescens 128, Mentana,
Virgilio, Abbondanza, Early Premium,
Funo (YrA), Danish 1 (Yr3), Jubilejina
2, Fengchan 3 (Yr1),
Lovrin13 (Yr9 ), Kangyin
655, Shuiyuan 11, Zhong
4, Lovrin10 ( Yr9 ) and Hybrid 46
(Yr3b+4b). Shuiyuan11-type 13 and 14 were
found in 1997, and Hybrid 46-type 3 was renamed CYR 32 in 2001. During this
period, 41 races and pathotypes were detected, and
CYR17, 19, 21, 22, 23, 25, 26, 28, Lovrin102, CYR29, Lovrin13-2, 3, CYR30,
31, 32, Hybrid 46-4, 5, 6, 7, 8, Shuiyuan11-2, 3, 4, 5, 6, 7, 8, 10, 11, 12,
13 and 14 can be found every year. CYR31 (10.8%-13.5%) and CYR32 (4.8%-11.7%)
were the first and second predominant races during 1997-2000, and CYR32 reached
the frequency of over 28%. In 2001 they became the most prevalent race. Basically,
CYR29 and CYR30 have similar frequencyranges of
2.6%-7.3%.Inaddition,CYR23,25,26,28,Hybrid464,5,7,8,Shuiyuan113,4,5,7,11,13and14werethe
common races with relatively low frequencies. All races and pathotypes
could be detected in oversummering regions located
in Gansu and Sichuan Provinces where
high diversity of virulence exists in Puccinia
striiformis population. Furthermore, Hybrid 46
and Shuiyuan11
pathotypes showed high frequencies of 78.5%, 80.2%, 76.6%,
78.7% and 87.4% during 1997-2001, thus the pathosystem
of stripe rust was not stable. This phenomen was
closely related to the low diversity of resistant genes in Chinese wheat population
with 80% Lovrin (containing Yr9 ) and Fan 6 derivatives.
Key words: wheat；
stripe rust； physiologic race； Puccinia striiformis
Simulation study on oversummering
process of wheat stripe rust caused by Puccinia striiformis West.in China ZENG Shi-mai (China Agricultural University,Beijing 100094, China)
Abstract： The oversummering
process (OS) of Puccinia striiformis and
wheat stripe rust was studied with the model PANCRIN. Simulations were conducted
based on variation of wheat-growing periods in the corresponding geographic
regions and the parameters relevant to OS. The results reconfirmed and intensified
the existing knowledge about OS with the following points. Besides the year
round wheat growing regions, OS could not be completed in any regions where
the single-season wheat is grown. The OS could be completed only in the regions
(RG) where the period of pre-harvest of wheat crop and the period of volunteer
seedlings overlap.The OS was weak on spring wheat.
The rate of OS was dependent upon the areas ofRG, length of overlapping period in this region, infection
rate, as well as the distance between the inoculum-source
region and the target region. As long as the average temperature in the 10-days
period during which the maximum temperature occurs in summer is <22℃,
the earlier the overlapping period occurs, the greater the OS rate is. Three
steps may be involved in a completion of OS: inoculum
accumulation-over summering-succeeding reproduction of the pathogen. The situation
of succeeding reproduction of the pathogen in Longdong
region, where the early-sowing winter wheat is grown, may have an important
influence upon the OS in the target regions, where the sowing date is later
than midOctober. Regional disease management with
the no-wheat-planting strategy in the regions where OS occurs may be affected
by many factors. To achieve a significant disease control, the area where
the no-wheat-planting strategy is implemented should be equal to or greater
than 95% of wheat-growing area. It is important to note that the low elevation
limit for OS may float up or down depending on climatic variations in summers
in two sequential years. Further
investigation on geographic or regional distribution and the corresponding
areas where OS possibly occurs prior to
implementing the no-wheat-planting strategy
for disease control in huge areas is recommended.
Key words: wheat stripe
rust; over-summer; simulation
PLANT DISEASE AND CONTROL
Inhibition of the infectivity of TMV by
tannins LIU Guo-kun, XIE
Lian-hui, LIN Qi-ying,
WU Zu-jian, CHEN Qi-jian
(Institute of Plant Virology, Fujian Agriculture
and Forestry University, Fuzhou 350002, China)
Abstract: The anti-TMV
activities in vitro were determined
with ethanol extractsfrom 15 species of plants.
The extracts of 11 species of plants showed significant anti-TMV activity.
The water phase showed strong anti-TMV activity while chloroform phase showed
little inhibiting effect. The water phase lost most inhibitory effect by discarding
tannins using gelatin. It showed that tannins may play roles in reducing infectivity.
Tannins extracted from Polygonum perfoliatum or Archontophoenix alexandrae seeds strongly inhibited TMV infectivity. TMV virions
seemed to be aggregated when incubated with the tannins. The fact that infectivity
of TMV recovered by dialysis from incubations in vitro with tannins showed that the virus regained infectivity,
and the tannins did not possess direct viricidal
effect. It seems that TMV coat protein binds the tannins. The tannins did
not affect multiplication of TMV in infected leaf discs. Tannins did not reduce
infectivity when applied either before or after TMV inoculation. It is proposed
that tannins from P. perfoliatum
or A. alexandrae inhibit TMV by binding to TMV coat protein to reduce TMV activity
or to interfere with recognition site for viral coat protein.
Key words: plant extracts; tannins;Tobacco mosaic virus (TMV); Polygonum perfoliatum; Archontophoenix alexandrae; inhibition; coat protein (CP)
RESEARCH NOTES
Primary analysis of population genetic structure
of Rice stripe virus in China WEI Tai-yun, WANG
Hui,LIN Han-xin, WU
Zu-jian, LIN Qi-ying, XIE Lian-hui (Institute of Plant Virology, Fujian Agriculture and Forestry University, Fuzhou 350002, China)
RT-PCR detection of Apple stem pitting virus in Kuerla pear
LIU Lian-ke, NIU Jian-xin, WANG
Xiao-bing, QIN Wei-ming
(Department of Horticulture, Agricultural College of Shihezi
University, Shihezi, Xinjiang
832003， China)
Abstract: Two methods for double-strand RNA(dsRNA) and three methods for total RNA were used to extract
the RNAs from fresh, refrigerated, freezing leaf
and bark of Kuerla pear infected with Apple stem pitting virus (ASPV). The methods
of total RNA extraction was improved by adding 1%CTAB, 2%PVP, 2% 2-mercaptoethanol
to extraction buffer, and low concentration ethanol was used to deposit amylose. dsRNA
and total RNA of high purity and integrity were obtained. Using them as template,
reverse transcription polymerase chain reaction (RT-PCR) was performed.This is the first report in China that RT-PCR was used to detect
ASPV in Kuerla pear. PCR amplification conditions
were optimized. A 316 bp fragment of ASPV was obtained
based on the optimum system. The results indicated that RT-PCR can be performed
well using total RNA or dsRNA as template, and dsRNA
is superior to total RNA.
Key words:
Kuerla pear; Apple stem pitting virus(ASPV); RT-PCR; detection
